GenePrediction:GLEAN_975 Details

Name: GLEAN_975
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:231838..234497 (+ strand)
Length: 2660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:231838..231850 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_146:231911..232187 (+ strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_146:232297..232843 (+ strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_146:232907..233087 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_146:233677..233774 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_146:234129..234497 (+ strand)
Length: 369
>GLEAN_975 class=GenePrediction position=GCSC_146:231838..234497 (+ strand)
ATGAGATTTGCTAGTAGGTATATCAGTCCCATCGAAAGCGAAATATGACTTGCTCACAATGCTCTTCAAACAGGCCCCGA
TGAAGTGCGGACGATCGTCCGCGAGGATCTAGGCTTCTATCATTCTGTTCTCGTCGGTGGTATTTACGAGTTCGAGGATG
CGACATATGGCTTCATCAGATCTTTGCTCTTTGTTTGGCCGCTGAGATACTGCATCGACAGACATGCTGCCTTGGCAGTC
GTTGTCAAAGACAGGCACACGGAAAAAGCATTCTACAAGCGGGCGCCCACGATGGACCTGACCAGCCACATTCAGATTGT
CCTAGGCGAGGACGAGGCCGTGGATAAATTGTCGAAGATTGAGCAGCACTACCTGTCTGCCCTCGAACTCCCATGGACTT
ATGCTTATCCGCCCTGGAGAGTGGTGGTATTGCCGTTGTCTGCGGGATGCTCTGGTCAGAGCCATTGTCTCATTACGTTT
GTCTTCTCGCACGCTGCTCGAAGCGTTGCACAAGCCCGTCGAAGCCGAGCAGACAAAGTCCACGTTGCGCATCGCACCAG
ACCGGGAGCTGGACCTCCCGTTTGACACATCAGAACGATTTTCCATATCGTGGGGCTACCTCATAGCACCGCTTCTAGGC
GCCATTCTTCCAAAATGGCTCGGTACACTGTGTAGTCTCAAGGCGGGTGTGGCCAGGAACGACGCGGGCACATGGACTGG
TCCTCCGATGTCTATCGATCCCAGCGACCCTGCTGCCACCCGGATCCAGCTGCTCGAGATCGGCAGCGCGGATGTAGAGA
AGGTACTCCGCGTTGCTCGAAAGTACGGCGCCAAGCTCGCGGCCGTCATGCACCAGCTGATCATCCAGGCTCTCGACAAG
GTGGTGCCAGACTCAAGGTCACCAACTGGCTGTCGCACACGGCCGTTAATATGCGGCCTGAAATTGGGAGCTTCAGATGA
TGAGATGGGCCTCTTTGTCACCGGCTGCTTCCAGTCGCACCCACGCGTGAACGAGTCGTCACCGCTGTCTGAAGCCGACT
AAGCTACCGCTCGCCTACTTACGGAAAAGTTGGCTCTGGGCGCAACCATCACGGAAAACCAGCCCATAGGGCTTCTGTGC
CATGTGCCCAACATGCGGAAGTGGACGGCAGGATTGATCGGACAGCCGCGTGATGGCTCCTACGACGTCAGCAATTTGGG
CGCGTTCTCGGACGTACAGAGCGGCTCCCAGAGACCATCAGTCCGGCGCTGTGCGTTGACGAAGATGGTATTCTCTCACT
GCACTAGTCCTATCGCCGAGCCTTTGGTCTTGAGTGTGGTGAGCGTCAGGGGAGGAAGCTTGATATTCTCGGTTGGCTAG
ACGCCCGGTTCTTTGGGAGTACCCGAGGTATCTGAGCCTGAGTTTGTGAGAGAAGTTTGTGCGTCTATACGTGAGGGTTT
TACCCACTGGAATAACGATCCGGACGAGAACAGGCAGCACAGCTTTATGTAATACGCATGGCCTTTCTTTGCACTATCTG
TTGTCGAGCATAGCCAAGCCGGCACTTTCATGTTGAGCCACAATTCTCTGGAAAGCAAGATTTACCTATATTGGTTCTAG
CATAATAATTAGATTTATTATACAGAGTAGTATTGTCAGGAAGTGTCTAGCATAGATCTCGCGAACTATGACGCACCCCG
AATACTACGGCCAATATTCTGCGACGGCCCTGGCATCATTGGGCACAAAATCGGTGACCGGGTACAGCTACCTCGGCTGT
TCCACCAACGGAGCAGTACTGATCTGAGTATCCTTAGACAGACATGTCTTTGAGATGATACTAGGACAACCAATGGCAGT
ATCTTGCGTCAAGTTGACGGCGCCAGATGACAGTGATGCAGACGACGAGGCTGGCGGGTCGCTGGAGACAGAGACAGCAT
ACGTGGTCACCTTTCTGGTGCGTCGAGTGGAGCATGTCGGCACAAGTCGGAAGCAGCTACACATAACAACACACGCTTTC
TCTGGGCACCCATAACTCAAAATCATCCCCCTGTCAAATATTGGAAACAACCCCCACTTATCTGCTTGGCTGGTGGCTGC
TTAGCTGGTGGCGATGTGCAGGCTGCGCCCCAGGTTCTCGTGTGCCTTCATGGTGCCGATGCACTCGCCCGTGATGGCGT
CCCAGATGCAGATCACGCGGCCGTTGCCGGCCGAGGCTACAAAGCACGCCAATAAGACGCCTACAGTTTCTTTTCTCTAC
TTTTCGAAAATTGGATCGCCGGATCCAGGCGGTCACTGATACGACACCAAGCTAGCCATCCGCTCGCTTGGCTACGGCTC
TGCTACCAAGGTGGCCATCAAATTTAAGCGTGCCTGGTGGATCCACGATCTGGGTAAGTACAGCATCAAGTTTGGCGGGT
TTAGCTACTCCGATATGAACATGCGCACGTGCGTGTACCCGTCCTACAACATCTGTGACGACAAAATTAAGACGGCCGTG
CTACTCTGCTCCTACAGCTGGCAACAGGATGCACAGCGCCTGGCGGCGCTTGTCTCCAGCAGCAAGGACCACGCGGAAAA
GGTCCACGCTGAGGCCGAGCTCAAGGAAGTGCTCATCCGCGAGCTCGTCTACCTGCACATAACGATGGTATGGACGACAA
AGCGCTTTACCGGCTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62