GenePrediction:GLEAN_976 Details

Name: GLEAN_976
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:237674..246461 (+ strand)
Length: 8788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:237674..237696 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_146:237749..239188 (+ strand)
Length: 1440
Type: CDS
Source: GLEAN
Position: GCSC_146:239369..239754 (+ strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_146:240082..241140 (+ strand)
Length: 1059
Type: CDS
Source: GLEAN
Position: GCSC_146:243779..244390 (+ strand)
Length: 612
Type: CDS
Source: GLEAN
Position: GCSC_146:244453..244871 (+ strand)
Length: 419
Type: CDS
Source: GLEAN
Position: GCSC_146:246438..246461 (+ strand)
Length: 24
>GLEAN_976 class=GenePrediction position=GCSC_146:237674..246461 (+ strand)
ATGTGGCCTCCCAGCCACAGCAGGTGGGACTCAGCTGGCACCAACGCTAACTTTTGGCACTCTCTTTCACCGAAGCTCCT
CGACCTCGACTGGGGACGAAGACCCAGGCCTCGGGCTTCGTGTCCTCCACAATCCCGAGGCTCCCTCTGTCGATGTCATC
TTTGTCCACGGCCTCGGCGGGCACAGTAGCAAGACGTGGTCAAAAAAACATGACCCAAAACTCTTTTGGCCCCAGCTTTG
GCTGCCGTTTGAGCCAGAAATGGGAACGGCACGCATCCTCACGTTTGGCTACAATGCAAACTGGCACGACTCTTCTAACA
CTGCTGCTAGAATTGAGGATTTCGCCAAAGCACTGCTTTATGAAATGCGCTTTGCCCAAGACGGCTCTGGCAAAAGCCTT
GGCATTGGATCCCACCCCCTTCTCTTTGTTGCACACAGCATGGGTGGACTAGTCGTAAAGAAGCTCGTTCTTCTCGGCAT
CCACGACGAGACTTACAAAGACCTCATTGCATCCGTATCCGCAATCATATTCTTGTCCACCCCACATCGTGGCACCCACC
TGGCCGAAACACTGAACCGATTGCTGGCTGCCTCTTTCCAATCGCCCAAGAACTTTGTCTCTGACCTCGAAAAATGCTCT
CCAGTCATCTCAGATCTGAACGAACAATTTCGGCATTTTGCGACGAGATTCTCCATATGGTCCTTTTACGAGACCCTCGC
AACTACCATCGGTCCTAAGAAGATGATGGTTCTTGAAAAGGATTCGTCTGTACTTGGATATCCCACCGAGATTTCTAAAC
CTCTGAACGCAGACCACCACGATGTCTGCAAATACTCCAGCCCCTCTGACAACAATTACATTAACGTCCGAAATGCCATA
CGATCTCATGTATTGCTTTATCGCAGGACAGACCGGGAAGAGAGTAAGAGTGACCTGGAGACAGAGGATATCCAAGAGCT
TTTCTCCGACTGTCCCTCTTCTGACGGAGACTACAACACTCTTCAGCAGAAGCTAGTTCCTGGTACCTGTGAATGGTTTG
TTCGACAGCCTGCCATAAAATCCTGGATTCGGCCATCACAAGAACCGCATGTGGCTTGGTATCACTCCAGCCCAGGCAGT
GGGAAATCGATGCGTGCGTCATTTTTGATCAAACACCTGACGGCTTCTGGAAGCGCCTGCCAATTTTTTCTATTTAAATC
CTCTGATGCAGCCAAACGCTCCGTTGCCAACTGCCTTCGCTCGCTCGCTTGCCAGCTTGCGAGGGATTTGCCTGCGTTCA
AAAATTCACTGCATACAGCATCGCCCCATAGCCTGGGCTCTGGTTCCCCAGAACCCTTGCTTCTATGGCAAGATATTTTT
GAGCGGCGCCTGTTTCAGATAAAACAGGTCGATCCTGTCTACTGGGTCATTGACGGCCTGGACGAATGTGACTCACCAAA
GGCTCTGCTATACTGCCTACAAAACCTCGCGGAATCCAAACTGCCTATCAAGGTCATGATCATGAGTCGCAATACGTATG
AAATTTCGAGCCTTGTTAAGCGGCTATCCCACAGTGTTTCTCTCTCATCGATCGAAGAGAATGGGATGGTAAACACGGAA
CAAGACATACGGCTTCTTGTGCAAAACGAATTAGAGTATATACGTGGCAGTCAGACCTTCAAAGATGATCTCCTTCTCAA
AATTGTGAGTCGCAGCGAAGGGAACTTTCTTTGGACAAAGCTCGTTCTGGACGAAATTCTGGACTGCCACACAGAAGACA
GCGTCAAGGATGTTCTTGCCGAGGTCCCCGACGACATGATGCTTCTTTACAAGCGCATGGAGCATAATCTTGTGTTATCG
AAGAAGAAATCCAGCCCGTCTCTTGTGGCGTCTATCAGAGCTATTTTAGAGTGGACTACGTGCGCCCAACGGTCGCTCAG
TGTGGCTGAGCTCTCACAGGCATTGAAAGAAGAACTTCCTGGGCTTCTGGATCTCAAGCGGACCATCACGGATATCTGCG
GCCAATTTATCTTGGTGGATAACGAGGACACGGTTGCAATGGTTCACCACACAGCTCGCGAGTATTTCACAGGCATGCGA
GGTAGTCGATTCTTTATCGACCCTCGCCTGACGCACAAAAAACTTCTAAGTAGAATGTTACAAGTGCTCGAGGCACCGGC
TCTTCCACTAAAACTGAAACAATCCCAGCATGTCCTCAGGACGAAAGAGCCCTTTGTATTTTACGCCGCCATCAACTGGT
CCTACCACCTCGAGCATTGCTGTACAGCCACTTCCCACATCGAGGTTCTCCAACTCCTCGTAGGCTTTTTTAGAAGCTCT
GCTCTGCTAAGCTGGATTCACACTCTGGCTCTGGTTGGACGACTCGAAATGCTTGCAAAAACGTCGAAGGCATTGTCGTC
TTTCACAGGAAGGACGCCTCAGATACATAGCTGCGAGGATCTCGACTACGTCGACAGTTGCGCCAATGATCTTCTGAACA
TTGTCGGAAAGTTTGGTCACAACATCGGAAAAGACCCCATGGTGATGTACGACATCGTTCCGGCCTTCTGTCCCGCAAAC
TCGATTGTACACAAACAATTCTACGGCCCACAGTCGTCAAAGATCAGGGTTCATGGGGCAAACAAAACCGGTTGGAACGA
CAGGATTGGGCGGTTTGGTCTTCCAAATGATGCTGAAGCTTGGAACATAACGTGCGCGGGGACACTGATCACCGTTCTGG
GACCCAATGGTGTGATCACCCTCTGGAATGCTATTGACTTCAGTGAAGTCGGTATGATCACACACGGGGAACCTGTAACG
GCTACCGCACTGAGTGACAATGGCCAAAAGCTGGCAACATACGGCCTTGCCACCACCAAGCTATGGGCCATCCCTGCGGG
AAAGCTGCTCTCCTCCACTCAAAATCCGGCAAATATCAAAGCAGTCTCACTGGCATTCGGAGATAATGACGGGACGCTTT
GGGTTAGTGGCGACGACAATGTCGTGAGGCATACACAGCTCGAGTTTCTTGGCCAGGGGTGGCAGGTACCTCATCCACAA
ATGCTTCGAGATAATCATCGTATCGTGGGTGCTATTACTAGCTCACCGACGTGTGTGGCGTTTGATGGTGACAGACGATA
TATGGGAGCATCCTACAGAGGATCACCGCTCTCTGTGTGGAGGCTTGAAGATGGAAAGCATGTGAAAATATGCAAACGGG
CAAAGACTTTCCAGCCGGGTGGTATGCCTCAGGCTTCGGCCAGCTGGGCTTCCGTTAAACGTTTCACGTGGAATCCAGTA
ACAGGCCACCTTCTTGGCATTTATGCTGATGGGTGCGTCTTCAAGTGGCACCCCATCACGAACGAAAATGTGGAGGAACA
GCAAGCAGCTGACGAGATTGCCGCAAGCCCGAACGGGCTCTTGTTTGTAACGAGCAGCAGCAACGGCTCTGTACTGATAT
GGGACTTTGCACGCTTCAAAGTCATCTGTAAGCTCTCTTTGGAAGACCTTGTCACAGCACTCACATTCAGTCCAGACAGC
CGTCGAATCTATGATGTGCGTGGCGGATGGGTCACTGCATGGGAGCCCAGCTGCCTGACGAGCTCTCTGGCAGGCGATGA
AGTGACAGAAATATCGGAGGCTGCAAACACCGAGCTTGTCACTACCTTGTCACCCGCTCCAGATGGTCGGACGTACTGCG
TCGGCTACGAGGACGGGCGCTGTTTGCTTTTCGAAAGAGGGAGATGGCAGGGTACCATCCTGGCACGATTCTACAATCAC
CTTGACATTACGCATGCAGTATGGAGCAGGGACGGTCGCTTTGTGGCAGTAGCAGACCTCGCGGGTGAAATTCAGGTCAA
GGCAATTATTCCATCCCCGACAGAAGAACTCGAAATTGTGCCGCTTCCAAACCCACAGATCGATCTTGACACCTACAGCA
TCGAGGAGCTGCTTTTTAGCTCTGATTGCAAGCGGCTCTTTGTGGCTTCGAAGAAAAATGCCTTTGTTTGCTCTATTGAA
AACGGCACCCTCGTCGCGCAGGCTAGCCTAGAGCATGAGCAGCCTCGAAAGTGGTTGTGTTACTCCAATCAAGAGGTAAT
TCTGAGCTTTGGGGAGTTTGGAGTCGAGTACTACACTTGGGATACGCTTGTGTCTTGCAGCCTTCTTTCCTTCGACGACG
ATCTGCAGCCCATAGAGCTTATGGCGAATCGTGAAACCGACCCAGAGACGGTATTTGGGATGGGCGAGTTGCGAAATTCT
CTGACAGAGAATTTTTCCAACAAGTGTTTTCGGGTGGAGAAGGTCATGATGTCTCAGGACAAAAAGCACGCTCTTTATTT
CCAGTCCCGAGTTGGCGATGTTGACGACTCTGATACTACTTTGGAGTTGTTCATTTTTCCCGGGCCGGAGCTTGTCAGAC
AGGCCTCGTACTTGTCTTCTTCTTTGTCGTACGTCTGGCATTCTCGAGTTCAAAGAGAAGTTGTGGCCCTAATCAAGGTG
CCTCTGGGAGTACTTCCGAGTGGTCGAACTGTGTTCATTGATAACGACCTGTGGATATGCTCATTTCAGCTCGATGACCC
GTTTGGCATTGTCAATACCGAGACATTGGTCCAGCGGCTCTACTTCATTCCACGAGATTGGGTCTATAACAGGAGCCTTA
GTCTTTGTTCTATGACTGAGGATGGAACGCTTTTCTGGCCACGCGATGGCTTTGTTGACCTGATCGAGTGTGATATCGAT
GATATTTGTATGGGATAATTAGGAAAAGTGTATATCGACCTTTTTTTTTTTAACGGATGCACAACACGTATTCAAACACG
AATTTAAGGAAAGGCGCACGTCGCAGCCGGAGAAGTCCCGCTCCGATCTCGTCAGGGCCTATGGGTCTCAGCACCCAGCT
CCAAACTGGAATCTTCTCTGGTGTCCTATTGCTCATGAGTACTTGACCCCGGCCAACTTGTAGTAGCCCACATTGTCAAC
GCCAGCGTGGGCGGGAGGACAGCGCAGGCTCTCTTTGTCTGCACGGCCGGGAATTCGAGTTCATAACCGAGTTTCGCAGT
ACCTCTACTTCTACTTTACACAAGCGTCGTGCCGAGGTACCGGGATACCAGAACGACTCTTCGGGTATGTTGTCGCCGAC
TTAGACCCTGTGATCCTTAAGCCGTCGAACGGACCAAGCCCACATGGGAGGGGCGTGCACGATTATGCCGTGTGATGGAA
GAATACATGTACTGTGTGGCGCATGGGGCTATTTAGTACGTGTTTGGATGCACGTCGGCATGAGCCAGCCATAACAGTAC
ACACAAGCTCATGGGGCACCCATAATTTGACAAAATCAGGTGTAGTGTAAGCAAATATATGTGTTGTACGGGGTACTCCG
TACTCCGTAGCAGATTCCTATACTCAACACCTGGATACTACATTGTAAAGATGTCGAGTAGACTAGGCTATAATAAGCTA
GAAGTAAGGACTTTCGGAATATAGCGTAATATACAAAGTAGTGCTGAGGTACTTATTTAGTAAGGGATTTTGTTGAAATA
AAAGTGGGCTCTCCAGCTGACCTTTGGGATTAAAACGTTGGCATCCCGAACCTGAATATCTCCAATGCTCCCGAAAAGCC
TCACTCTCGCCTCCCTCCCCCGGTACTCAGTGCCCTCTGATTGCACTTAGCCCTTTGGTCCCACCCTACCGCGGTAGCTT
ATGGGAATCTGCGGCAAGCTACTGCGGTAGTGACACGACAGATGTTGTATGTTATCGCAGAATTGTATTGGTGTAAGTCT
AGTTTACGTGGGCTGTGGCATGTTCGAGCAAGCTGACTATTTTCAATGACTGTGGATTAGAACCGCAATGACATTATTAA
TCAAGCGCAGTATATAAACAGACCTGGCGTCTGGTATAGATTCCTCCAACAGAAGTCATAGTCACTTGTAAAATCAAGCT
AATAAATGTATTACAACCATCACCGATTCATACTTCAGTTCCAGCATTATCACAACATGTCGTGGCTACCACCAAAGGAC
TTTGCAACTCGTCCAATCACCATACTGGGAGCGGGAGTTCTTGGACGCCGCATTGGTATTCTCTAAAGTCTATTAGTCTC
AAAAAGGTCTAACCAGTCCTTACAGCATGCGCTTGGGCATCTGCCGGGTATGATGTTAAAGTCCGAGGCCCGAGTCTCGA
GCAGCGTTCTCAATGTTTGCAATATGTCGACCACAACTTGGACACATACCTGCAGCAGACATCCGGAAACAAGGGTACCG
TTCATGTATTCGAGGACGCCTGGCTTGTTATAGAAGCTGTACCAGAGAAGATCGAGCTTAAGATCGCCACGTTCGCTGCA
CTGGACGCCATCGCGCCGCAAGATTGTATTCTTTGCACCAACTCCTCCTCATACAAGTCATCTGAGATGTTCTCCAAGGT
CTCGGAGCCGATGAAGAATCGTATCCTTAACGCGCACTACTACATGCCTCCAGCTTGCATGGCTGTGGAACTTATGACAG
ATGGATTTACCAACGAAGCCATTTTCCCCTTCTTGTCAGACAGACTCAAGGAGACTGCGGCTTTCCCATACACTGCTAGA
AAGGACAGCACAGGCTTCATCTTCAACAGACTCTGGGCGGCCATCAAGCGTGAGATATTAACGATCTTGTCTGAGGGCGT
ATCCGTTCCCGAGGAGATCGATAGCATCTGGAGCAAGCTGTTCAATGGAAAAACGTTGCCGTGCAAACTAATGGATGGTA
AGCTATGGTCTCCTACTGTTGACATTGCATATTTCAAGTGCTGATAATGAGTGGTGCAGATGTTGGCCTCGATACTGTGG
CATCTATTGAAAGCCATTACATTTCAGAACGTGGTTTGAGCTCGAAGGCCACTGTTGACTATCTCAAAAGCACCTATCTC
GATCACGGCAAATTAGGTTCCATGTCCCCCAATGGAGGCTTGTACCCGCCTAAAGCCAAGACGGAGGATCAAGATTGCAC
TACGTCACCCAGCTCGACTCTGCTCGTTCTCGATGTCGGTCTAGGTGCTGCTGAACCAAGCACAACATCAGGAGAGATTC
TTCAAATTGACACCAACGGTGAAAACCTCAAGACAATACTCTTAAAGCAAGCATTGCCAGACGGAATCGCCGTCTCTCCA
TCACGCGGCAAGTTCTACTGGACACAGAAAAGACCTCCCAAGGCATTATGTACTCTTCGCAGTCTTTGCACCGCGGCAGT
AAGAGGCTCTGTTGCGCGTAACTATGTAGGTGAGTTTGCAGACTTTTTACTGCTGCAGTGCATGCATCCGAGTAATACAT
GCACTTCCATCAGAGTTCGCTTCTGACTGCCTCGCCGCCAAAATCAATCACGTGATAAACCATGTGCGGAACAATATTGT
GGCAGTTGTTCTAGAACAAACACTTAACGAATCAAAGTTGTCACTTGCATATGCTTGGATCACATTGATTCTTCCCGGAA
GTTCGTCCGACGCTAGTGAAACAAGAAACAAATGCCAGTCCAGATCTTCCTCTTCGCCGTTCTCCTAATCTTATCCCTTC
TCTCCTTTACTTCGTTCCCTTCACTTCTCCCCTCTCTCGAATCCCTTCTATCCTCCCTCCTCATCGAAATGCTAGCTTCA
CGTCTGCCCGCGGCCACTCATACATGACATCGCCGCCGTAGACGTTGGTCGTGATGTTACCAATGCGCAGCTCGACCTCG
CCGTAAAAGGCCTCGCACTCGCGCAGGACACGGCTGATGAGCGCCTTGCTGACGACGGGATCATCGGGGTTGCTGTTCTC
GCCACTGGTGCTAAAGTGCTTCTCGACGCGCTTGCGCAGGGTCTCGATGCCCTTGCGCACCTCGCGGCCGTCATAGCTGC
CGAGCACCTTGTTGAAGATGGCCTTGGTGTTGCTCGGCTGGGCGGCCACGGCAGCCGGCGCCTTTCCGGCGGCCAGCTGT
GCCTCGACGTTCTCGAGATGCTCCAGAAGACGACCGAGAGGCCGGCGCATGACGGCATTGAGGTAGAGCCCCAGGTGCTC
CTGGATCTCGGCCGCGGCCGCTTCCTTCCAGTCGTCCAGCACCCGGGTCCCCCGTGGGTTCTCCACGTCCTCGAGGTAGT
GGTTCATGTTCTCGATCAGCAGAATGTGGAAGTTGAGCGCCTCCTTGTCTTCGGGATCGGTCGCCGAGGCATTGCCGCCG
TTGTTGCCGCCGTTTCCACCGCCTCCATTGCCGGCCACAGCTGCTGCGATGCTCAGGCTGCCACCACCGCCAACGACGCC
CGGAACGAGCCCACCGGCAGCCGTGATCGTCGGGTTCTCGCGTGCAATCACCTTGAGCGAGTCGAACATGGATCGCAGGA
TTCGGTCGTATTCGTGGTCCACCATGCGGCACACGCCCAGGTTCGGGTCGGCACCGTCCAGCATGTTCTCGACAGCTGCG
CTGAAGTGTGGGAAGATGCGCATGAAGCCGATGACACCCTTGCGTTTCTTGATCTTGACCTTGGTCTCTTCGATGGCACG
GATCTGCTCGTCGACAAACTTGGTGAACCGGCCCTGCAGGGCTGCGTGCAGTTTTTGCAGCACATTGTTGAGGAAATCCT
GGTTGGAATGGCTGATGTCGACGAGCTTGTGTTCGAGCGTTGCCAACACACCGATTCCTTGTCTAGGGGGGTTAGTGGGG
AAAGCAAAAAGAAAGAAAGAAAGAGAAAAAAAAAGAAAAAGAAGAAAAAAAAAAGAAGAAAAAAAGAAAAAGACGAAAGA
ACACAAACTCACAATGCTTCCAAAGACAACACCCAGTTCACCAGGCTCTGCAGATCCTGCTCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62