GenePrediction:GLEAN_977 Details

Name: GLEAN_977
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:253414..255518 (+ strand)
Length: 2105
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:253414..253710 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_146:253773..255518 (+ strand)
Length: 1746
>GLEAN_977 class=GenePrediction position=GCSC_146:253414..255518 (+ strand)
ATGGGTGCTGCAGTTCCATACCCGCTGGACCCCCTCAGCGCGGAGGAGATCAAGGCAGCGGTGGCCATTGTCAAGAAGGC
GCACGGTGACGAGCTGCTGTTCAATGTGGTCTCGCTGCACGAGCCACGCAAGGTGGAGATGACGGCCTGGATGGCCAACC
CGGGAGTGGCGCCGCGGCCGGTCCGCGTGGCTGACGTGGTGGTGATTGCGCCGGGCTGCAAGGTGATTGACGGGCTCGTG
GACCTGTCTTCGGGCAAGATCATCAAGTGGGAGGGCCTTTCGGGCGTTCAGCCGATTGTGAGTGTGGCCTGCTCCTGTAT
GATGGCCAACGGCTGGTCAATGACGACTAACGGCCCCAGATCACGGTCGAGGAACTGCAAGTGGTGGAGCACATGTGCCG
CACAGATCCCAAGGTGATTGAGCAGTGTGTGATCAACGGGGTGCCCAAGGACGAGATGCACAAGGTGTACTGCGATCCGT
GGACGATCGGGTACGACGAGCGGTTCGGCAACAACGTGCGGCTGCAGCAGGCGCTGATGTACTACCGGCCCAACGTGGAC
GACAACCAATACCAGTTTCCGCTGGACTTCTGCCCGATCTTCGACAGCATCAAGCAGGAGATCATCGCGATCGACGTGCC
CAAGGTGCGGCGGCCGCTCAGCAAGGAGCCGGCGCTCAACTACCACGTGCCCGGGGTGGAAGCACAGGGTGGCTTCCGCA
AGGACCTGAAGCCACTCAACATCTCGCAGCCGGAGGGCGTGTCGTTCTCGCTGGACGGACGCGAGCTGACGTGGCAGAGC
TGGAAGTTCCACATCGGCTTCAACTACCGGGAAGGCATCGTGCTGAGCAACATCACGTACAACGACCACGGCAAGGTGCG
GCCGGTGTTCTACCGCATGTCGCTGGCCGAGATGGTCGTGCCGTACGGCTGCCCCGAGAGCCCGCACCACCGCAAGCACG
CCTTTGACCTGGGCGAATATGGCGCCGGCTATCTGACCAACAGCCTGACGCTCGGCTGCGACTGCAAGGGCGCGATTCAC
TACCTCGACGCCGACTTCCCGACGCGCAGCGGCGACGTGCGCACGGTCAAAAACGCCATCTGCCTGCACGAGGAGGACGC
CGGGATCCTGTTCAAGCACACCGACTTCCGCGACGATTCCGTCATCGTCACGCGGGCCCGCAAGTTTGTGGTGCAGCAGA
TCTTCACCGCGGCCAACTACGAGTACATCTGCCAGTGGATCTTCCACCAAGACGGCACCATCCAGCCCGAGGTCAAGCTG
TCCGGCATCCTCAACACATACGCCATGACGCCCGACGAGGACACGCACGGCTGGGGTGTGCAGGTGCATCGCGGCGTCAA
TGCCCACAACCACCAGCACCTCTTCTGCCTGCGCATCAACCCCAACGTTGACGGCGGCCCGAACACGGTCTACACGTCCG
ACGCCATGTCGGGCGAGGCCCCAGTCGGCAGCCCCGAGAACAAGTACGGCAACGCATTTTATGCGAAGCGCACGCGCCTC
GAGACCGTCGGCCAGGCCATCACCGACTACGACCACATGACCAGCCGCTCGTGGGACATCTGCAACGAGAGCAGCATCAA
CCCACACAGCGGCAAGCCGGCCTCGTATAAGATTGTCAGCCGCGAGGTTCCCCGTCTGCTGCCCAAGGAGGGCTCGCTCG
TGTGGAAGCGCGCCGGGTTTGCGCGTCATACGGTGCACGTGACTCCCTACGAGGAGGACCAGCTCTGGCCGGCCGGCCGT
CACGTGCCTCAGACCAGCGGCGAGCCGTCGGCCGGCCTGCCGCAATGGCTTGGCGACGGCAAGGCGAGCGTGGCCAACAC
CGACATTGTCGTCTGGCACACCTTTGGCCTGACGCACTTTCCCTCGCCCGAAGACTTCCCAGTCATGCCGGCCGAGCCGA
TCACGCTGCTGCTGCGGCCACGCAACTTCTTCACCAGCAACCCGGTCATGAACGTGGCGCCGTCGTTCAACAGCACGCCC
AGCCAGGTGGCCGCGGGCAAGGGCGTGTACGATGCCGCCGACAAGCTGAGCAAGCTGGCCTTTGCTGACGGCGCCACTGG
CGGTAGCTGCTGCTCAAAGTTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62