GenePrediction:GLEAN_97 Details

Name: GLEAN_97
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:661027..662768 (+ strand)
Length: 1742
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:661027..661112 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_179:661181..661265 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_179:661475..661496 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_179:661677..661940 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_179:661997..662435 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_179:662502..662671 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_179:662743..662768 (+ strand)
Length: 26
>GLEAN_97 class=GenePrediction position=GCSC_179:661027..662768 (+ strand)
ATGTCTGGAGGATATCCTACCCAGGGCTACGCTCCCTATGGCGGCGCTCCTCCGCCGGGTGCCTTTGCTGGTCCAGCCTA
CGGTTTGTAAGCTTTCGTGTCCTGGACAACCCCCTTGCTCGGAATACATCTGCTAAACAAGCTGGTTTCGACAGCCCTCA
ACAGTATGGTTACATGCCCCCGAACCAGATGTATTTCCAGCAACAGCCGCAGCCGATGCAATCGTACGGTTACAGTCAGG
TAAATACTACCCTCGCTGACCGGACTACTCTTTAAGAGAAACTTGTATGGCGACTAACCTCTTTCGTTAACCGTCGCCAC
TACCACAGCAGCAGCAGTCGCCGACACAACACCATCAACACCACCCTCAACAACAACCAATACCACTACCAGCACAACAG
CCGCCGCCACAGCAACAATACAGCGGCATGTACACTGAACAGTCGCAGTATACAACCAGGCCAGGGCCGGGTATGTCCTA
CCTTCGTCCCCCTGTCGCCTCTGGGTCTCTTACGTTGCAGACAGCTAACACGCATCGTAGGAATACAATATATGGATCCC
TCGTCTCCGAACAACATGAACAAGCCACCGCAAACACCACAGCAGTTTGGCGGCGGTGCTCCGCAAGGCTACGCTTTCCA
ATACTCCCAGTGCACGGGACGGAGGAAGGAACGCTTCTGATTGGTATCAACTACTTTGGACAGCGCGGCCAGCTGCGCGG
CTGCATCAACGACGTGCGAAATATGTCATCGTACCTGGTGGAGCATTTCGGCTACCGGCGCGAGGATATGGTGATCCTCA
CAGACGACCAGCAGAACCCAATGAGCCAGCCGACCAAGGAGAACATCCTGCGGGCAATGCACTGGCTCGTGAAGGATGCA
CGGCCGAACGACTCTCTTTTCTTCCACTACTCTGGTTAGTACTTTTCTTGTTCTGCTCATGCGTCATCTGGATCTAACAA
GCATCGGCAGGTCACGGTGGGCAGACGCGCGACTTGGACGGCGACGAGGACGACGGCTACGACGAGGTGATCTACCCGGT
GGACTTCCGGACGCGCAGCCACATCACGGATGACGAGATGCATCGCATCATGGTACGACCATTGCAGGCCGGTGTTCGGC
TGACGGCCATCTTCGACTCGTGCCACTCAGGCACAGCGCTGGACCTGCCGTACATCTACTCGACGCAGGGCATTCTCAAG
CAGCCCAACCTGGCGAAGGAGGCAGGCCAGGGCCTGCTGAATGTGATATCATCGTACAGCCAGGGCGACATGCACGGGGT
TACGAACAACATCCTGGGCTTCTTCAAGAAGGCCACCGGTGGCGACGAGGCCCAGGCGCGTTCTCTGGCTACCAAGACGT
CGCCGGCTGATGTCATTATGCTCTCGGGCAGCAAGGATGACCAGACTTCGTATGTGATTGATGCTGTTTCTGGCGTTAGT
GTCATTTACTGATCAGCTTCTTCTCTCTCCTACAGGGCGGATGCGACGATTGCATCACAGGCTACGGGCGCCATGTCGTG
GGCGTTCATCTCGTCGCTGAAGAAGAATCCGCAGCAGAGCTATGTGCAGCTATTGAACAGCATCCGTGACCAGCTCGAAA
GTCGGTACACGCAGAGGCCGCAGCTGTCAAGCTCGCACCCTCTTGGTATGTTGCCAGCCTCGGTGTCTCGCTTTCGTGTT
GAGCGTGGACAGCAGGTTTCTAACTGACAGCTTTAGATACGAATCTCCTATTTGTAATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62