GenePrediction:GLEAN_980 Details

Name: GLEAN_980
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:265604..269124 (+ strand)
Length: 3521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:265604..265843 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_146:265962..266846 (+ strand)
Length: 885
Type: CDS
Source: GLEAN
Position: GCSC_146:266905..267060 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_146:267715..269124 (+ strand)
Length: 1410
>GLEAN_980 class=GenePrediction position=GCSC_146:265604..269124 (+ strand)
ATGAAGTTTTTCGTCCAAGTCGAGGAGCATCTGAACGGCCGAGCCTTTGGTCCTGGTGACGAGGTTCGGGGACGGGTAGA
GGTGCCGGCCGACATGGACGCAGCCGCTGCTGGCCGACGTGTGCCAGACGTCTCCGTCGTCTTCCAGGGCACCGTTCGCC
TGTCCATCGTCCCGCAGACGAGCCTGGATGCCGTAGCCCAGGTGCCCAACGCAGCCAGCCAACGAACACATACTTACACG
GTTAGTGCAACTTGCGAAAGGCAGCCAGCTGTTGCCAGCTGTTGCCAGCTGTTGCCAGCTGCTGCCAGCTGGCAGCAACG
GTAAAACAGGATAGCCGTGTACTGACAACCGTCTCCAGCTCTTCTCGCACTCCGTCACAGCCACGCCCAAGCCGAGCATC
GCGACCGACGGCCGGATCGTCTACACGGCACCCTTCACCTTCCGCTTCCCTACAAGCAGCACCTGCTGCGACAGCGGCTC
ATCCTGCGCACTGCCACCCTCGATCGACCTCAACACGGCCAAGGTCCACGCCAACGTCGTCTACAGCGTCACGGCCTCGG
CCCGGCGCCTGAAGCAGAGCGGCCTGCAGCTGCTGCCGCAGTCGTGGCGCCGCCCGCTGCACGCGCAGCAGGTGCTGACC
TTTGCACCAGACCTGCCGGTCACCGTGTCCTCGGCCCAGCCAGCTGCCGGAGAGGTCGACCATGCCGTTAGTGCCGACGC
CATAGCGCTGTCGCGCATGCACATTCCCAAGACGACCTTTCTCGGCAACGGCAACGACGACGATGATGAGTCAATACCGC
ACACCCTGCCACCCCCCTACACGTCGTCCATGGCGCAGGCACTGGAGCTCGTGATGCCGCAGCCGGCCGTCATTTCACCT
GGTAGCGGAGGCGTCGCGCTGGGCGTCTTTTTGCGCACGCCGGCCGACCTGTTGCCACCCGGCAGCTCGGGCGCTATTCT
CCGCGGCGTCCGCGTGCAGCTGCGCCGCGAGACGGCTGCGCGCATCGGCAGCTTGGTGGCCCGCGCAGCACCCGTCAGCT
GGCCGCTGTGGTCTGTTGAGGGCGCCGTGCCTATGGGTCGGGAACGCGTCGACATTACGGCAGTCTGTGGCGGTGTCTGG
GCAACGCAGTGCTGTGTGCCGGCGGCTGCTCGTCCTAGCTTCCGCTCGTGCTATCTCTCGCAGTCATACACCATCGAGGT
TGAGGTCAGCGTGTCGGCCTCCCCGAACTCGACAGACATACGGGTAAGCCACAACTCGCTTCACTGGCCCTGTTCTCTCG
CAGAAAACTGACAGTCAATAGTATATCCATTCATCAATCGATGTCGTCGTGTCCGATCCGCCGCCAGAGTACTGCACCCA
GACGACAAGCGTCCCAAATCAAGACCCGTACAGCACTGTCGACCTACAAGTTGGGATGGGGGCCCCGTCAAATTGGTCTA
GCCCTTCCGTAGCGGAGGTGAGAGTTTAGGGGGGTTGCCCCGGGATTAGCTTTAGCGTTGCGTTGTTTGCTCTTTTTCCA
GTGTAATACCCAATTGATCTCCTATTTACCACAATAGCGGGGCGCATTTCGTGTCTCACGTTACTCTTTTATTAGCATAC
CGCCCGTATTCTGCCCATTAACAGCCATCTTACGGAAGTACTTCTTTAACCTCTTATTGACAACTTTACTATGCTTTCTA
GCACAACTATACGTCTTCGAAATCTCTCTGTCAAAGGGGCCTAAGGAGCTCTTAGGCTATAAATTCCCATCGTTGGGTAT
CTTTCATGGACAGTCTGTAGGTTAAGAATAAAGCTCCTTAAAAACCGCACGGTAGCTTGTTTCCTGAAATCATGCGTGGT
TGGTTTGATTATAGCGGGGTACAAGGCGGTGGAAGTACTCCGTACGGAGTAATACGAAGTACGAGTAGTGCGGATAGCAC
CTTTTCCATTCATTCACCGCAAATTCCGTATTATCCGACAGCTTGTACGCTAGGCGGCAAAACCGGCCACATCCAAGTAC
TTCTAACTGGGCCCGAAATTTATGTCCTCTGCTACAGGATGATGAAAACAGGGATGGCTCCCGTCATAGCATATTTGTGA
TTGCAGGCCGCTCTCTCTTCTTTGGCCACAGGGCGGACATGCTGAGATGGAGCTCCAGCAAGCTGCCCGCGATGGGTCAA
GCCGCCATTCTGGGCCCCATTATGAGGGCTACACACCCGACCGCTTTGAAGATCTCAATGAGGTCCGCAGCCCGCCTCCG
GTCGAGAACCCGGACGAGGCGGCCACATACCGGCACCGCAGCATCGAAGAGGACGTTGAGGACGAGCGGCGCCGGTGTCG
GAAGCCAGAGTCAAAGCACGCCAGAGTCCACGCTCCTCGCACCGAGCTGTACACTGTCGGCCACCTCGTCTTCTTCTCGC
TGCTCGGCACGCTGGCCCGTCTTGGCCTCGACGCGCTGACCAATTATGCTGGTGCACCAGTCACCTTTGGCGTGCTCTGG
TCCAACTTTGCCGGCACTGCCGTGATGGGCTTCTTGGCTGAGCTGGCGCCCGCCATCAATCGGCACTTGGCTGTGGAAAG
TACTCCCGACAGTCGCAATGTCGCTGCAGCTGCATTGTCGTCTCCTTCGGCTTCATCACCAACACCATCGCCATCGCCAT
CGCCATCGCCATCGCCATCGCCACCACGGAAACTCCCTCCAGTGCCGCTGTATATCGGCCTAGCCACCGGCTTTTGCGGT
TCCTTCACGTCCTTTTCGACCTTTATGCTAGACGCCTTCGAGGCCATGGCCAATTCGCTGAAGGCACCACGCTACCACCA
AAATGAGGGCGGCTCGTCCTCGCCCGTCTCTCGGGGCGTCGGCGACGACATAATGGCTCTGCTCGCCGTCCTACTGCTGA
CCATCGCCATGTGTGCCTCGGCCCTCAAGATGGGTGCGCATCTAGCCGTTTTTGTCGCCCGCTGGTGGCCCTTGCCGCCT
CCTCCATCGCCACACTCGTCCTCGGCCTGGTCGCGCCACTTCCGGCTCGGCCTCAATGCCTCCGCCGTCTTTCTCGGCTT
CGGCTGTTGGCTGGGCGCTGTCCTCATGGCCATCTTCCCTCCTTATGGCACCGGCTTCGGCAGCTGGCGTGGTGACGCCG
TCTTCGCCCTCGTCTTCGCCCCGCTTGGAACCCTACTGCGCTTCGGCCTTGGCCTGCGGCTCAACGGCATCTTCGCTGCC
TTCCCCCTCGGCACCTTTGCCGCCAACGCCATCGGCACCGCCATCCTCGCCATGGCCTGGGACCTGCAGCACGCCCAGCC
GTCCACTGGAATCGCCACCAGCATCACCGCCTGTCAGCTGCTCCAAGGCGTCCTCGACGGCTTCTGTGGCTGTCTCACCA
CCGTCAGCACCTGGATGGCCGAACTGAACGGCCTGCGTCGGCGCCACGCCTATGTCTACGGCGCCACCACCGTTTCCACT
GGTCTCGGCCTGCTTGTCGTTATCGTCGGCCCTCTGCGCTGGACTGTCGGCTGGCACGAGCCCACGTGTCAAGGGAGGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62