GenePrediction:GLEAN_981 Details

Name: GLEAN_981
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:271991..274438 (+ strand)
Length: 2448
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:271991..272909 (+ strand)
Length: 919
Type: CDS
Source: GLEAN
Position: GCSC_146:272992..273661 (+ strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_146:274099..274438 (+ strand)
Length: 340
>GLEAN_981 class=GenePrediction position=GCSC_146:271991..274438 (+ strand)
ATGAGCGACTCGGTTGAGGAAGAGAAGAAGATCGGCTTTGACGCCATCGTCGCCGCAGACCTTGCTGGCACCAGCCACCG
GAGCTCGGCCGATAACGATGTCTACGGCGAGGCTTCCGCACCGAGAAATTGCTTCACCCTCTTTCTCGCCCGCTTGCGCT
CCTATGAGGCATGGCTCGACCGCCTGCTCGGTGTCGAGGCCGAGGGCATTGCACGTCGCCGGCCTGAGGATCGCGACCCC
AAGTACGCCCGCTGGTCCAACCAGATCGTCATGTTCATGCTCTGGATGAGCACCACGATGAACCTCAGCTGCTTCACCTC
TGGCTTCCTCGGCTGGGAGCTTGGCCTCGACCTCGGCCGTTCCGTCACTATCATCATCTTCGCCACCCTCATCGGCAGCG
CCATCACCGGCTGGTGCGCCACCATGGGTCCCGGCATGGGCCTGCGTCAAGTCTCCATCTCACGCTACTCGCTCGGCTGG
TGGCCCTCCAAGGTCGTTGCTGCCCTCAACGTCGTCGAGCAGGTCGGTTGGTCCTCCGTCGGCTGCATCACCGGTGGTGT
CGCCCTCTCTGCCGTGTCCGACGGCCATGTCAGCTCGTCCCTCGGCGTCGTCATTGCTGCTGTCATCGGCTTCGCAATCT
CCTTTGTCGGCCTGCGTGCCGTCTTCACCTACGAGAAGTTTGCCGGCATCGTCCTCTTCATCGTCTTCATCGTCATGTAC
GGCGAGGTCGGCGGCTCTGGCGACTCCGTCACTCCCACCCTGCTCACCGGAGCCACCCTTTCTGGCAACGCCCTCAGCCT
CTTCGCCGCCATTTACGGCTCCTCTGCCTCTTGGTGCTCCATCGTGGCCGACTACTATGTCGAGTACCCGGTCAATACTT
CCAAGCTCAAGGTCTTCCTTATGACCACTGCCGGCATTTGTAAGCCTTTCTTATTTTCTAAATCTCTTGTCCTCTTTCCA
GCACATCAACGACCTCTTAAAACAGAAACTAACCCTCCAAGGTCTGCCGACCTGTTTCGGCATGTGCCTCGGTGCCACTG
TCGGCTCTGCCCTTGCCCACCACCAGGACTGGTCGGATGCCTACGATCACAGCGTCGGCTTCCTTATCGCCACCATGATT
CACCCCGTCGGCTTCGCCAAGTTCCTGCTCGTCCTGCTGGCTCTCTCTGGCATCGCCATGAACGCCGTCGCCCTCTACAG
CGCCGGCCTGTCTGTCCAGCAGTTTGCCCGCCCCTTGGGTGCCGTTCCCCGCTTCGTCTGGACCACCATCATGTTTGCCG
CTGTCATTCTGCTTTCTCTGGTTGGCCGCAACAAGCTGCTCACCTTTTTGCAGAACTTTTTGTCTCTGCTTGGCTATTGG
AACACCTCCTTCTTTGTCATCCTTTTCGTCGAGCACTACTTCTTCCGACATGGCTTCACCCGCGGCTTTGACGAGTACAA
CCTCGAGGCCTGGAACAGTCCCAGTCTTATGCCCGTTGGCTATGCTGGAGGTCTCGCTTTTGCTGCTGGAATCGCTGGTT
GCGTTGTCGGTATGAGCGAGTCGTGGTACGTCGGCGTACTTGCACGTCTAATTGGCGACGACGGCGGCGATATTGGAAAT
CAGCTTGCTTTGGCTTTCTCCTTTGTCGTATACGTACCTGCGCGCTGGGCCGAGTACAAAGTTATCGGTCGGTAGGTGGA
CATGCGTACGTAAGACGAGGAGTAAATGCTCAAAAGGGTTTGACTGGTACTTTCAATTGCTATTGAAATATATGACATAA
TCTGTGCAAGGCATCATTTATGCACTTCCACGTTGTACTCAGGGCAGTGCCCAAAGTGTTTCCCAGGGTGCTTTTCTCCG
TCGTACTACCTTCTTCACGACAACACAGAAGTCCCATCCATCGGCGAGTGGCCCGAAATTTTGTGTCACTGTCCCTGTCA
TCCGGCGTCTTTTCGTGGATCAGTGGCGCGCGGCCGATTTTGACATCTCGGATGGAAGAAGCAACTCGATAGCCCATGAA
ACTCTGCAACAGGAGTGCGGCAAGGCTTATCCCGGCCGACACCCACATGAACACAATCGCAGTCACGCCGATCCGATTCC
CAATATTGACCTCTTTCTGAAAGGAAAGGCCGACCTTGATTGCGACGGAAATTCCTGTGGCGATGGACGCACCCATGAAG
TTTGACAACGTTGACATGGCCGCGATGATGGACACGGGCAGACTCCACCATCGAGAAAAGAGTACGATGGGCGTTGCAAG
AAGCAATATGCAGTCGAGGATGGCTCCGACAAAGAGGGTGCCGAACATGACTTTGGACGTGATACGAAGAGCCTTTAGCA
TTGCTACTGCCGTTGACGGAAGAATGATTTTGGAGCTCTGGAGAAGCTCATCCAGAAACACTTGCTGGGGGTTAAACCAG
AAGAAGATCCGTGGACGGGCACAGCTGGCGACGCCGGTGTCAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62