GenePrediction:GLEAN_984 Details

Name: GLEAN_984
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:281425..284893 (+ strand)
Length: 3469
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:281425..281615 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_146:281697..282875 (+ strand)
Length: 1179
Type: CDS
Source: GLEAN
Position: GCSC_146:282924..283337 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_146:283413..284114 (+ strand)
Length: 702
Type: CDS
Source: GLEAN
Position: GCSC_146:284327..284438 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_146:284696..284893 (+ strand)
Length: 198
>GLEAN_984 class=GenePrediction position=GCSC_146:281425..284893 (+ strand)
ATGGCTCCCTCGGAACCGGCTCGTGAGCGGCAGCGACGCCGCAAGATCACGCTCGCCTGCGAGCCCTGTCGCGAGCGCAA
AGCCCGCTGCGACGGTCGCAAGCCCATCTGCTCCACCTGCGAACACCGCTCGCTGGGACTGGAGCAGTGCATCTACAAGG
TCGGAAATGCACGCACGGCTTGCAGTGAAGAGTGAGTTAGTGCGAGCGATGTGCAAAGACGGAGGAAGAAGGATGAAACA
TGCCCCGGCTTACCGTTCCCCCCCCCCCACAGTTACATGAGGGCTCTTCACGAGCGCATCCGCAGACTCGAGCAAGCTTG
TGCTGCCAATGGAGTCGACATCTCGGCCATCGAAGGTCACGGATCAGATCCGAGCGCCTTTCAGCCGGCACCGCCATCCG
CCTCGCTGGTCCGCAGTCCGACCGAGCCCATCCTCGGCCTCGCGGACCGTCCTCCAGAACACCAGACGACTGCTGCATCG
GCCACATCTAAATCCACGCCTGATCCCGAATCTACCGATCCCCCTCGGGGTGTCTCGGGCATGGGAACGGTGCTCGAGGA
GGACGACCTCGACGGTTCTGCGCGTCCTGGTGACGACTTTTACGGTCTCTCCTCCGCGGCCTCCTTCCTCAAGGAGGCCG
CCAACTCCATGCGTCGCCGCAAGCAGCTCGACAGTCCTCCGCACAACCTCGACGACTTTACACAGCCGTACCAGCAGTAT
CAGCAAAACCAGACGCTCCCCCCACCTGCTCCTCCGCTGCTTGGCACCGCCTCTTCGTCGTCCTTGCTGCGCTTCGCCCC
CGTCGACAAGTTCGCCCTGCCGCCACGGGCGCTAGCCGACCACTTTGTGCAGCGGTACTTCGAGCGCATCTTCTATCTGT
ACCCTTTCTTTGACCGTGTCGCCTTTGAGCACACATATCGCAGCCTATGGAGCGCACCGGGCGAGGATGGCCACGGCAGC
AGTAGCAGTGGTAGTGGCAGTGCTTCTGGGCATGCCACCGCGGCTACCGGTGCTACCACTGCTTCCACCAACGCCAGCGC
CTCGAAGCCGCTCAAGTTTGACGGCTGTGGACTGGGAGACAGCGACGCCGGCGCCAGCTCGATCCCGTTCCACTGTGCAC
TCAACGCCATCTTCACGCTGGGCTGCTGTTTTTCAGACCTGCCCGAGGCCGAGAAGACGGCGTCGTGCGAGGTGCTCTTT
AACCGGTCCAAGGCCTTTGTCGGCCTCGACTTTATCGACGAGAACAACGTGGGCGTGGTGCAGTCGCTCCTAATCATCGC
CCTGGTCCTGCAAGGCACCCCCTTTCCCAACCGCTGCTGGAATGCTGTCGGCATGGCCTGCCGCGTGGCCCAGGGCCTGG
GACTGCACAGTGAGGCTGGTCGACGACCACGCAGTGCGCGAGAAAAGGAGATGCGACTCCGGACGTGGCACGGCTGCGTT
ATCATGGATGTGTAGGTGATCCTTCTACTGACGGTTGTGTTTGCGTGCTGACTAAGCAGTCTTGTGGGCATGACGTTTGG
CCGGCCAACCTTGTCTTCCAGCCTATCGATCCCGCACAGCACGTTCAGTATGTACCCAAGCGTCGGGTCCCCGGCGCTCG
AGACCAGGTCGGAGCAGTTGCGCTTCCTCTTCTTCCGGGAGAGCGTGCGGCTCAGCGTCATCCTCGAGGGCATCCTGCAA
AAGATCTACGAGCCGTGGATGACACACGACAACAATGCCAGCGGATCCTCGACCACTGGACAGCTGCACATCCACCACAG
TCTGGACACGATCGTCGAGCTGCAGGACCAGCTGACCGGCTTCGAGCAGTCGGTCGCCCCGTATTTGTCATGGGTCACAC
CAGAAACGCCCGACAATGTTTCAGCAGAAGACCTGCACGTGTTGGAGATGCAGAAAAACGTGCTACACGCCAGGTTAGGT
CCCGTGTACGAGTATGCGGACGCGTGCTGCCGAAAAGAGTTGTGCTGATTGTCTTTTTGACGGCCTAGGTTCGTCTACAT
GCAGCTCATCATGCACCGCCCCATCCTGACGCAGCTAGTGGCGCCCGAGGGCACGGCACAGCACGGCAGCAGCGAGAGCC
GACATGAGCACAGAGCGGCGGCAGGCTACACGCCGCTGTCACGTGACGGGCTGCACTACGCGTTTGCGCTGGAGTGTGCC
AAGGCGTGCGTGGAGGCGGCGAAGCGGTTGATCCTGCTGGTGCACCGCACGTACCTAACGGACCAGACGGACGCGTGGTG
GTGGAATGTCTTGTACACGTGCACGGCCGGGCTGGTTCTGATTGTGCTGCGCCTGTGTCCGGACTTGTGGCAGATGCTGG
ACCGGGACGAAATCGCAGAGCTGTGGGGCCGATGTCAGTCGGTGCTGCAGCAGCTGGCATACTTTAGCGTGTCGGCCCGC
AAGTCGATGACGCTGCTGCTCAAGGTGAACGAAAACGTGCTGCTGAAGCAGGCCGCCATGGAGGGTCGAGGTGGGGAGGG
CGAAGGTAGCAACGACGTCGGCGCCACGGCGAACATCAACAGCCAACAAGCAGTGGATCCGACGCTTGACCGGGACCAGG
ACGCTGCCGAGGCCCAGCTGCAGGCCCACGTCGACGGCATGATGGCTCAGCTCGACCCGGCCGGGATGAGCCTCGACAGC
GCCTTTTCATTTGCACCGCTCTTCAACTGGGACCAAAATTTGGACTTTATGTACACGACGCCTTGAAGGTTTGGCCGTCA
GCTGTCAGACAAAGCGCGACTTCGGGCTCCATCGGCATTGCCAGAGCATCGTGGACATGTATATGCTTTTGAGCAAGCTT
GCCTTGCTACACGACCATTGCAGAGCAGGAGCGTGACGAGCTATGGGCTTCACTGTAAGCACACAGAAACTGCTGAGCGG
GCGGTGAGCGAAAACGAGTGAGGCTGGCGGCCGACCTGGCGGGCAGCATGCACGCCATGGCCGTCTGCCAGGCGAGCAAG
TCGATCTACGAGCTGTTCGACCGCCCATTCTTCCTGGCCCAGAGCCACAGCACCGTCTAATTTGCCGCCATGGGCGTGCG
GCGCTGTGACGGCGTCGAGAACCCGGCCGAATGCATGCTCTAGATTGTCACCATCTTTACCATTTTTACCAGTCTCGTCC
AGTAGATTTAGCCGTTCTTCGACACGCAACGGGCCCTCTACGAGGTGCGCGAGTGCCCTGGAAAAATGTTCTCGTTGGTA
GCCTTTATGATGGCCAGTATCGTGGTCGAGTAGCCATACCTTTGCTCACGGCCGCGTGTCGCTGCCATTAGGTGTTGACC
GCGGACGAGAATCTCTCGTCGGCCGGCATCCGCTGGGGCGAGCGGTGGCGCAACTTTGGCAGCGTCTGGGGCTACGTGGC
ATTTAACGTCGTTGTGGCCATCTCGCCGTATTACATCTTGCAGGTGCGGCGGTGGAGCATGCTGGAACTGTCGCTGTGTC
GGAAGAAGAAAAAGCAGAAAAAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62