GenePrediction:GLEAN_986 Details

Name: GLEAN_986
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:290901..303025 (+ strand)
Length: 12125
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:290901..290958 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_146:291028..291185 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_146:291251..303025 (+ strand)
Length: 11775
>GLEAN_986 class=GenePrediction position=GCSC_146:290901..303025 (+ strand)
ATGGCGTCCGTAAGCATAATCGACAGCATCCTGCGGCAGCTCGCCACGGCAGATTTGGGTGCGTTTGCCGTCTTCTTTCT
CTGCTCTCCTGCTCTCTTGCCTGCGGGCCACTTCTAACCGGACGCAGACGCCAAGGCAAAGCTCGATGCCGCCGTGACCC
TGCGCGACTACCTGGACCACTACACCTCAGGACCGATCTACGCCCAATTCCTCAAGAAGGTGATGCCCATCATCTTCAAC
ATTCTCAATGGACCTCCCAGCTTCCAGAGCGAATCGCCCGAGCAGGTACGGTCTCGCCCCCCTGCCCTATGTCTTGTGTG
TGTACCGTCTTGTCCCGCTGACACGCTCAGAAACTGCGCAACTGCATGCTCGAGATCATCCACCGATTCCCCTCCATTCC
CACTCCTGTCGAGCCGTTTGAGCCCTACGCCGAGGAGACGATCGACCTTCTTTCCAAACTGATCCAGACCGACAACGAAG
ACAATGCATGCCTGTGCATTAAGACCGCTGGCGACATTCTGCGCCACCAGCACAAGGTCTGCGCCGCCAAGGCGCAGTTG
TTCCTCAAGCTCATCGAAGAGCTGTTCTCGCAGACCGAGCGCATCGTCAAGGAGCAGCTCGACAACGAGCCGGCCGACGG
TGGTACGACCGGCTCCGTGGCCGCTGGCGCTGCAGGTGCTGCACCATCGACGCCGGGCAGCTCACAGGTCGGCTTCGCGC
AACACCAGCCCGGCTCGCCGGGCGTGACTGGCGGACTGGAGGTCGATCGGCAGCTGCTCAAGGGCATGCACTCGTTCAAG
GTGATCTCGGAATGCCCCATCATCGTCGTGTCGATCTTCCAGATGTACCGCGCGAACATCCCGCAGAGCATTAAGACGTT
TGTGCCACACATCAAGTTTGTGCTCTCCGTCCATCCCAAGGCACAGGAACAGGCACACAGTGAAGCCGCCAAAACCGGCA
CATATTTCTTCGGCATGAGCCCCAACATCAAGAACAAGACAAGCTACGGCGACTACATCACTTTGCAGGTCAAGATGATG
AGCTTCCTGGCATATGCGCTTAGGCAGTACTCGCAGCAAATGTCCGACTTTCTCGTTCATCTGCCGAAAACGATCATCCG
ACTCCTGCGCGACTGTCCGCGCGAGAAGGCCGCCGCTCGCAAGGAGCTGATTGTGGCTATCCGCCACATTATCAACTTCA
ACTACCGGCGCATCTTTGTGACCGTGATCGACGAGTTCCTCGACGAGAGAACGCTGTTGGGTGACGGCCTGACCGTCCAT
GAGACGATGCGTCCTTTGGCCTACAGTATGCTTGCAGACCTCATCCATCATGTCAGGGACCACCTCCAGCCGGCGATCAT
CCGCAAGACTGTGGCGATCTACACGAAGAACCTGCTCGACGATTTTCCGGGCACCAGTTTTCAAACCATGAGCGCGAAGC
TGCTGCTCAACATGGCTGAATGCATCGCCAAGATGGAAGACAAGGTAGAGGCACGCCACCATCTGGTGACCATTCTCAAC
GCTATTGCCGACAAGTTCGCCGCCATGAACCGCCAGTATGACAACGCCCAGAAGCTGTCCAAGGAGTACAGCGACCTGCT
GGATCTGCAAAAAGAGCGGGCCAGCAAGTCGCCCACCGCTCTGGGCATGGCCGCCTTCTCCGAGACCTTCCTTGCCGATC
CGAAAGTGCGGCCACAGTGGGACGAGATCGACCTCTTCACGGCGGCGCCGCCCATCAAGCTGACAAACGCGCGTGAGCGT
GGCCATGACCCCGTGGGTGACAACAAGTTTCTCTTCAAGACATTGATGCAAGGCTTGCGTAACACCGTCTTTCAACTGCG
CAACTGTGCCCAAAATCCGACGATTGACCCGGCCATCGCGCCTCCGGGATGGTCTGATGTGGCTAGCGGCTTCAATGCCG
AGGAGGTCAAGGTGATTATCAAGCTTTTCCGCGAGGGCGCCCGCGTGTTCCGCTACTATGATAGTGCTGAAAAGGTCACG
GCTGAGCCGCCGTTCGCGTCCATCGTGGAGTACATGGCCAACTTTTATATGGTGTCCAGCTCCAAGGAGGAGAAGGATTT
GCTGGAGTCGTTTGCCACGCTCTTCCACGTCATCGATCCGGCCACGTTCAACGAGATATTCGAGCAGGAGGTGCCCCATC
TCTTCGAGATGACTTTTGAACACACCGCTCTCCTGCACATTCCACAGTACTTTTTGGCCAGCGAGGTCACATCGCCAACC
TTTTGCGGCATGCTCTTACGGTTTCTGATGGAGCGCATCGAGGACGTCGGGCTTGCCGATGTCAAGAAGGCATCGGTGCT
GCTGCGCATGTTTAAGCTGGCATTTATGGCAGTCACCTTGTTTGCGGCGCAGAACGAGCAGATCCTCCTGCCGTATGTCG
TCGACATCATCAGCAAATCGGTCGAGCTGTCGACCCGTGCCCAGGAGCCAATGAACTACTTTCTCCTCCTGCGCTCTCTC
TTCCGGAGCATCGGCGGCGGCAAGTTCGAACATCTCTACAAGCAGATCCTGCCGCTGCTCGAAATGCTTCTGGACGTGCT
GAACAACCTGCTCCTGGCTGCCCGCAGGCCCATCGAGCGGGACCTGTACGTCGAGCTGTGCCTCACGGTGCCGGCTCGAC
TGAGCAACCTGTTGCCCCACCTCAACTTTCTTATGAGGCCGTTGGTGGCTGCGCTGCGCGCTGGCTCAGATATGGTCGGC
CAGGGGTTGCGAACACTGGAGCTTTGCGTCGATAACCTCACGGCAGAGTATCTGGACCCGCTGATGGCGCCCGTGCTGGA
CGAGCTGATGCCTGCACTGTACGACCAGCTTAGGCCGCATCCGTACAGCCACTTTCACGCCCACACTGCCATGCGCATTC
TGGGCAAGCTGGGTGGCCGTAACCGGAAGACGATGACGGACCATCTCCCGCTGTCGTTCAAGCAGTACATTGACGACTCG
CCGAGCTTTGATGTCCGGCTTGTCGGCTCAAAGAAAGACCGGCCGTTCAACGCAGACCTGGGCCTCGAACTGGCCCTGCA
GAAGATCATGGAGATGCCGGGCAAGCCGTCACGAAACCCGATTTCGAAGCAGTCCGACGCGTTTTACAAGAAGCAGGCCC
TGCATATGATCAAGGCCCACGTCAAGATGCGCATTGGCTACGACAACCTGCCCGATGACCTACCGCGGCTGGTGCGGTTG
CAGGCACAGGACCTGCTAGCCAAGAAGCTGGACGTGGACCTAGCCGTGTTTGAGGAGAGCCACCGCGAGCGGTCGGTTGC
GAAGAAACACGAGATGGAGGACATGCTGACGCGGCTGATCAAGGCGCTCTTTTACGCAGAGTCAATTGAGGACCTGCGGG
ATGAGGCTGACGGCTTCCTGATGAACATTTGCCGGCACTTTATCTTTCTCGACATTGGGCGCACGCTCATTAGCTCCAAG
CGGGCCATCACGGCCTTTAACGCGACGACGGGCGAGGGGCCGCTGGTGCTCGACTCGCATCTCCTGGCCGACGCCATCCT
CGAGTCGCTCTCGTCCATGCAGGAGGACGTGCGGAAGGCGGCACAGCGGGCGATCGAGGTGATGTTCAAGACGGCGGCAG
TGATCTTTGGCACGGAAGACGGGGTGCATGTACTAGAGTTCTTTAACCACCTGGCTGCCACGTTCACGCACGGCTGTTAC
GTGGAGGAATGGTTTCTCAAGACGGGTGCCTGCCTGGGCATCCAGACGCTCCTGACGATGGTCGATCTGGGCGATGCATG
GGTGGGATCGATGCAGATGGAGTTTATCCGGTCGCTACTGTTCGTGGTGAAGGACATGCCCCCCGACCTGCCGGAAACGA
CGCGCAGCCTGGCGCAGTCGACGCTGGAGATCTTGCTGGAGCGGGTGACCAAGGGCCTGACGAAAGAGGACGTGATCCCG
TCGACGGACGACAAGGAGCAGCGGGACAGCGAGACGCCGAACGAGCAGAGCAAGCGGAGACTAGGACCGCGGCGGCTTCC
GCAGACGTGTCTGCTCCTGGCGACGGAGCTCTCACACATGAACAGACACGTGCGCAACACGGCGAAGCGGTCACTGGAGC
AGATCGCCAAGGCGGTCAACATGGAGGTCTGGGAGGTGATTGAGCCGTACAAGGAGCGTTTGTTGTCGCCGCTGTTCCAG
AAGCCGCTGCGGGCGCTGCCATTCTCGATCCAGATCGGCTACGTGGACGCGCTGACATACTTTATGACGCTCAAGTCGGA
CTTTGTGGTGATTGACGAGAACGTGGAGCGGCTGCTGACGGAGTCGTTGGCGCTGGCCGATGCGAGCGACGAGTCTCTGG
CCGGCAAGTCGGCAGAGTTCCGGACGCACAACTTCATCGTGGACCTGCGGGTGGCCTGCATCCGGATCCTCAGTACAGCG
ATGGGCTTTGACGAATACCAGAAGGGCCAGGGCAACGCAGCGCGGTCCAAGATAGTGTCGGTCTTCTTCAAGTGCCTGTA
CGCGGAATCGAAGCCGACGATCGAGGCGGCCAACGAGGCGATGAAGCGGGTGCTGATGTACACGAACAAGCTGCCCAAGG
ACCTACTGCAGTCGGGGCTCCGGCCGGTGTTGGCCAGCCTGCAGGAAGCCAAGCGGCTGACGCCTCACGGGCTCGAGAAC
TTGTCGCTGCTGCTGCGTCTCCTGACAAACTACTTTAAGGTCGAGATTGGGACGCGACTGCTAGACCATGTCAACAAGCT
GGCGGAGCCAGCAGCGGTGCAGCAGATCTCGTTTGTGCTGTTTGAGCAGAGCCCGCTGATGAAGATCATCGTGGGCGTGT
TCGGCGTGTTCCATCTGCTGCCGGATGCGGCGCGCATGTACAAGGAGCGGATCATCGAGGCGGTGCTGGACCTGGAAGAC
AAGCTGCGCCGGACGCACTATAGCGCGTTGCGGGCGCCGGTGTACAAGTACATGGGCCGGTATGCAGACGACGTGGGGCA
GTATCTGATGGGTCGGATTGAGGAGCTCAAGTATGGGCGGTTCCTGTCGCAGGCGCTGCTGGACGGCGAGAGCCGGTCGC
TGCGTGACTACTGCAACGCCCACGTGGACGATCTCATCAGCAGGTGCAACACGATTGTGCTGGAGCAGAAAGAGACGGAG
TCGATTGCGGTGATCAACACGATCCACATCCTGTATGCGCTGTGCATCCGCAGCACTGACAATGCGGAAGCCGTGGCGGA
TGGCAGCAGCAGCAGCAGCAGCAGCAGCAACTCGGCGGCCTGGCTGGAGAAGAAGGAGCATCTGGTGTGGCTGAAGACGG
TGGGCCGGACGCTGGAGGAGCGACTCAAGGCCAACTCGCTGGCGCCACATCTGCGGCTCGCGGGCAACCAGGCGGCTGAG
CAGCTGATGACGATCCTGACGCGCAGCCTAGAGCTTCACGTGGAGGACACGGAAATGCTGCTGGGGCTGGTGGAGACGGT
GACGTCGGAGGACCTGCGGGCAACGCCGGTGTTCTTTGCGCACATCTACCGGAACATTGTCAGCAACGAGCGGGTGGAGT
TCAGCAAGGTACTCGTGCTGCGCTGTCTGGAGGTGTACGCAGGCAAGACGGCGACGCACAAGACCAAGTCGTTTCTGCTG
CACTACATGGTCAACCCGACGGTGGCGATGTCGATCATGCGCAACTGGGACGTTCTGGGCGAGGAAGAGCGGGAGAAGGG
AGCGCCGCTGCTGGCGGACAAGCAGATCATCGAGTCGATCACGGAGAAGATCTGGAAGACGAACATGGTGGACCACCAGG
ATGAGGTGTCGACGCGGTCGGGTGGCGTGGACTACACGCGGATGGAGGTGATGCAGCTGACGGCAATGTTGGTCAAATAC
CACCACGCGATCCTGCAGGATGTGCGCAAGGACATTATCAAATTTGGCTGGACGTACATCCGGAACGACGACGCGATGAA
CAAGCATGCGGCCTACGTGGTGATCGGGTACTTTATCCAGCACTACGACACGCCGGTCAAGATCGTGTCGCAGGTGTACT
ACTCGCTGCTGAAGGCGAACCAGAGCGAAGGCCGGGCGCTGGTGAACCAGGCGTTGGAGATCATTGCGCCAGTGCTGCCG
ACGCGGTTTGGGTCGAGCGACCGGAACGCGGCCTGGGCAGCGGCACCGCGACGGATCCTGGCAGAGGAGAGCCACAACGC
GCAGCAGACGAGCAGCATCTTCCAGTTCCTGGTGCGACGGCCGAACCTGTTTTACGAATCGCGCGACAAGTTCACGATGC
TGATTATCATGTCACTGCGACGGGTGGCGAGTCCGGGCAACGCGTCGAGCGAGAGCAAGCGGCTAGCCCTGAACCTGATG
TGGCTGATCTGGCAGTGGGAGCATCGACGGGTTGAGGGCACGCTGATCGACGAGAGCCGGCGAGGACGAAGTGGGAGTGC
AGCCAAGGCGTTAGGATCGCCACGATCGACATCAGAGTCGCCACTTTCGCGGAAGCGCAAGCTCGAGACGGCCGAGGAGA
AGCGAGAGGGTCCAGGCTCGCCGATGGTGTTGACATCAGCCAAACAGGAGTATCAGGTGCCGGCGATGGGCCGACAGAAG
ATGCTGCGGTTTCTGATCGAGTTCATCGCGCAGCTGAACGAGCGATACGAGCTGCCGACGTCGAAGCCCAAGGACCCGGC
GACGCAGCCGTCGTTTCCGTGGAGCGATCTGTGCACGCGATCGATGGCACTGCTGTTCAACCTGCTGCAACCACGATTCT
GGGGCGTGGCAGACGTGGAGCTGCTCTCTCACGCAACCGAGCTCGTGCTGACGGGCGATAAGGCGACACAGGCACTGGCG
ACCGAGCAGGGCGACCGGGACCCAGCGGACGATAAGTTCATCGGCACGATTGTCAACATGCTGCAGGTGGTGCGGGTGAT
TCTCAACTTCCAGCCGGACGAGTACATTGTGACGAACATGGAGGCGATTCAGCGACTGTTGGACAAGTGTCTGCGGTCGG
ACAACGCGGAGGTGCAGGACTGTCTGCACACGGTGACGACCGAGTACGACGACGGCCGGCAGCTCAAGTCGATCATCGGA
CGGATCCTCGAGACGGTGCCGGAAGACGTGCACATGGAGGATGTCGACGGCGAGGGCGAGGTGGAGGCGCAGCCATCCGA
ATTTGTGACGTTCTTGTCCAACGTGGCAACAGAGACGCTGGGAGCCAACAACTACATAGCGGGCATCAACATCCTGTGGT
CGCTGTCGAGCCGACGGCCAAGCGCGGTAGACCCACACATCCAGGCGCTGCTCAAGACGCTGCAGTCCAAGCTGGGCCGC
GAACACTTGGCCCATTACACAGCAGCAGCAGCACAGGCAGCCAATCCACACGGCCGAGCCTCCCATGCAGCCCAGCAGCA
GGACCCAGGACTAGCCGGCGCAGAGATGACGCCGTTCAACCTGATGGTGCAGTCGGGGCTGATCGTTCGGGCCATTGACG
TGCTGGCAAAACGGATCGAGACGCTGGGCGACAACCGGCGACCCTTTCTCAGCGTGCTGGCCAACCTGGTGGAAAAGTCG
CAGGACGTGCGGCTGTGCAGCACCATTCTTGACCTGGTCGAGGGCTGGGTCTTCAAGTCGGAGGGCACGTGGCCGACGCT
TAAGGAGAAGACGGCGGTTCTGCATAAGATGCTCGTGTTTGAGCACCGTACCGATCTGACGATGTTGCAGCGTTTTCTCG
ACCTGGTGCTGCGCATCTACGAGGACCCCAAGATTGCGCGTACGGAGATCACGGTGCGGCTGGAGCACGCCTTCTTGATC
GGCACACGGGCACAAGACGTCGACACGCGCAACCGCTTCCTGGCCGTCTTCGATCGCAGTCTCGCCAAGTCGGCCAGCAG
TCGTCTCGGCTTCGTGATCGCGGAGCAGAATTGGGACACGCTGTCGGAGTCGTTCTGGCTGGCCCAGGCGTCGCACCTGC
TGCTCGGCGCCGTCGAGATGGGCGGGGCCGCACAGCTGCACGCCGACGACGTGCGCGTGCAGCCGCTGTCGCAGCTGTGC
AGCATCTACGGCACCGATGGCCGCGAGCCGGCGCTGATGGTCGACGATCGCTACGAGGCTTTGGTGGGGACGTTGCGACG
TCACGTGACCAGTCTGGCCGATGTCCGTGTGCGCGACCTGCTCGAGCCGCTGACGCACCTGCAGCACACAGACGCGGCGA
CGGCCGGAGCGGTGTGGGAGACGCTCTTCCCGCTCTTCTGGGGTGCGACGCTGCGCGAAGACCGTGCCGAGCTGGAGCGC
GGCCTCGTCGGCCTGCTGGCCAAGGAGTACCACAACCGGCAGATGGACAAGCGGCCGAACGTGGTGCAGGCCCTGCTGGC
CGGAGCTGCGCGCGCCTGGCCTGACTGTAAGGTTCCACCGCATGTTCTCAAGCACCTAGCACGCACGTTTGACGCCTGGT
ACGTGGCCCTGACGCAGCTGGAGCGCGCGGCCATCCGGCCAGAAGTGGCGTCGGTCCACGTGCGCGAGAGCAATCTGGAC
GCGCTGGTGGAGCTGTATGCCGACCTGAAGGAGGAGGACCTATTCTACGGAGCCTGGAGGCGACGCTGCCACTTTCTCGA
GACCAACTCGGCCCTGTCGTACGAGCAGAACGGCATATGGGACAAGGCGAAACGAATGCACGAAGCCGCTCAGATCAAGG
CGCGCACCAGCGTGATTCCGTTTTCGCAGAGCGAGTACATGCTCTGGGAGGACCACTGGGTCATCTGTGCGCAGAAGCTG
CAACAGTGGGAAATCCTGCAGGACTACGCCAAGCACGAGAACTTCCAGGATCTGCTGCTCGAGTGCGCGTGGCGCAACTT
TGACATGTGGCAGGAGCAGACGAGCCGGGACCAGCTGGACGGCCTGATCAAGGGCGTCATGGACGCACCGACACCGCGCC
GTGCCTTTTTCCAGGCCTTTATGGGCCTGCTTCGCTTCCACCACAAGCAAGACACGATCCAGGAGTTTGGGCGCGTGACG
GACGAGGCAATCCAGCTGTCGATTCGCAAGTGGCACCAGCTGCCACGACGGCTGACTAATGCGCACGTGCCCCTGATGCA
GAACTTCCAGCTCATGGTCGAGGTCCACGACGCAAGCATCATCTGCAACAGCCTGGCGTCGACGACGCTGATGAACCTGG
ACGCCAAGTCGGCCGAGCTTAAGCTGCTCCTGGGCTCATGGCGTGACCGGCTGCCGAACATGTGGGACGACATTCTGGCG
TGGCAAGACTTGGTCACGTGGCGCCAGCACATCTTTAACCTCATCAACAGCACCTACCTCAACCTGCTGCAGCCACCGCC
GCAAGGGGGGGCGGCCGGAGCGAACGGACAGGCCGGAGCGGCAGCCGGACAGAACGGCCAGGCCGGACAGGCGACGGGAT
CGACAGCAGCCGCGACGGCAGCAGCAGCCGCAGCAGCAGCAGCAGCCGCGGGCGGATCGTCGTTTGCGTACCGCGGGTAC
CACGAGACGGCGTGGATCATCAACCGGTTCGCGCACGTGGCACGCAAGCACGACCTGCCGGACGTGTGCATCACGCAGCT
CGGACGGATCTACACGCTGCCCAACATCGAGATCCAGGAGGCGTTTTTGAAGCTGCGCGAGCAGGCCAAGTGCCACTTCC
AGAACGCAGACGAGCTGACCAACGGGCTGGACGTGATCAACAACACGAACCTCAACTACTTCAGCCCGCCGCAAAAGGCC
GAGTTCTACACGCTCAAGGGCATGTTCCTCGAGCGGCTCAGCCAGAAGGACGAGGCCAACACGGCCTTTGGTACCGCGCT
CTTTTACGACATCACGACAGCCAAAGCGTGGGCCGAATGGGGCTTCTTCAACGACCGGATCTTCCAGGCCGAGCCGACCA
ACTACACGGCGGCGCGCCAGGCCCTGACGTGCTACCTGCAGGCGGCGTCGAGCTACAAGAACGCCAAGGCGCGCAAGCTG
ATTGCGCGGATTCTCTGGCTGCTCAGCCTGGACGATGCGGCCGGCACCATCGCCGGTGGCTTCGACGATTTCAAGGGCGA
CATTGCCACGTGGTACTGGATCACCTTTATCCCGCAGCTGCTGTCGGGTCTGACCTACAAGGAGGCCGTGCGGACTCACG
CGATCCTGCTGCAGATTGCCAAGACGTATCCGCAGGCGCTGTACTTTGTCCTGCGCACGAGCCGCGACGACATGCTGGCC
GTCAAGAAGAACCAGGAAGCACGCGAGCTGAAGGTGGCCCAGCAGCAGGCAGCCAAGCAGCTGTTGCAGCAACAGCAGCA
AGCAGCAGCAGCTCAGCAAGCACAGCAGGCTCAGCAGGCTCAGCAGCCGTTGATCAAGATTGAAGGAGACGGCGGGTCGT
CGTCACGGCCGAGCACGGCCAACGGTGTGGGAGGTGCGTCTGGGACGGCAAAGAGCGAGACCTCGGATGGGGCGAATGGG
ACGGCAAATGCAGCATCGACAACGACAGCGCCCATTCTAGCACCTCCGCCACCACCTCCACCACTCCATCCGACCAAACG
ACACCCGTGGGACTTTATGGAAGACGTGCTGGTGGCAGTCAAGTCGTCGTTCCCGCTGCTGGCACTGTCGATGGAGACGA
TTATCGACCAGATCCAGAAGCACCTCAAGTGCCCGCCAGACGAGGACGCATACCGGCTGATCGTGGCTCTGCTCAACGAC
GCCATGTCGTATATCAGCCGGTCACCGGCGTCGTACAGCCGAGACGTCAAGCTTCCGGCAGCGACCGAGTCCAACATCAC
GCGGTTTGCCGAGACGGTGTTGCCGACACACATCCGGCCCATGTTTGAGGAGGAGTTTGTGGTGGTCAAGCCGACCATGT
ACGAGTACATCCAGAACCTGCGGCGGTGGCGCAACAAGTTTGAGGACAAGCTGGACCGACGGGCAGGACGGGTGCCGCTG
GAACAGCTGTCGCCACACCTGTGCGAATTCCGATACCTCAAGCTGGACGACATTGAGATTCCGGGGCAGTACCTGCAGCT
CAAGGATAAGAACTCGGACTTTATCCGGATCGAGCGGTTTATGCCGCAGGTAGAACTGGTACGAACAGTTGGGGTGTCAC
ACCGACGGATTCGGATCCGTGGCCACGATGGCAGCGTCCATCCGTTTGCGGTACAGCAGCCGACAGCACGCAACTGCCGG
CGCGAAGAGCGGGCGCTGCAGCTGTTCCGGCAGCTCAACCAGCGGCTGCACCACAAGAAAGAGAGCCGGCGACGCGACCT
GCAGTTCACGCTGCCACTGGTGGTGCCGGTGGCCCAACACATCCGCCTGGTGCAGGACGACCCGACGTACGTGTCGATGC
AGACGATCTACGAGGAGCACTGCCGCGAGAACGGCTTCAGCAAGGATGACGCAGCCATCTTCACGATGGAGAAACTGGCC
GCGTTGAGCGATGCGCAAAAGGGCGGCAGCAACGGCAATGGCAGCAACGGCAGCGGCAGCAGCAACAGCCACGGCGGGCC
GCCGAGCCAGCAGGCCATGTCGACACGGCTGGAGGTGCTGGAGGCCATCCAGGCGACCAAGGTGCCGAACACGGTGCTGC
TGGAGTATTTCCAGCGGACGTTTGGCGACTTTGCCGACTTCTGGCTCTTCCGCCGCCGGTTTGCCTACCAGTACGCAGCG
ACGACCTTTATGACCTACATCCTCTGCGCGGACAAGCGGTACCCACACAAGATCAACATTGGGCGCGGCTCCGGCAGCGT
GTGGAGTGCCGAGGTGATGCCGTTTATGCCGATGAACCAGCCGTACTTTAAGAACCCGGAGACGGTGCCGTTCCGACTGA
CGCCGAACCTGCAGGCGCTGATGGGCCCGCTGGCGGTCGAGGGCATCTACGGCAGCTCCATCATGGCCATTGCCCGCAGC
CTGGCCGAGCCAGAACAGGAGCTGGCCTATGCCCTCACCCTCTTTGTCCGGGACGAGATGGTCTTTTGGTTCACGAGCAA
TAGGCACGCTCAGCAGATGACCGAGGACAAGCTGCGCCGCGCCGTCCAGGCCAACATCGATCTGGTGACCAAGCGGGCCG
CCAGTCTGGCCCAGACGCCCGTCGGCAACCTGCCGGCCCATCAGACCGCCATCGACCTGATCGCCAAGGCCGCCAACCCG
GCCAACCTCGCTATGTGCGACGTGCTGTGGATGGCGTTTTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62